Jump to main content or area navigation.

Contact Us

Microbiological and Chemical Exposure Assessment

EPA Technology for Mold Identification and Enumeration

The presence of molds in homes, schools and business is of growing concern in the United States. To begin to understand the significance of exposure to these organisms, a standardized technology is needed for their identification and quantification. In May of 2002, the EPA was granted patent 6,387,652 which describes mold DNA sequences that makes their identification and quantification possible. This relatively inexpensive technology has been licensed by firms in the U.S., Germany and the United Kingdom.

The patented technology teaches the best available DNA sequences to use for over 130 of the major indoor air fungi. It is particularly useful, in that a a licensed company can employ a technician or robotic system to analyze samples and obtain highly reproducible results in only a few hours -- eliminating the need for plating and culturing or identifying and counting. Other analytical techniques may take days or week to complete. Most typical sampling systems can be adapted for use with this technology.

One of the problems with mold exposure estimates has been the lack of a standardized method for describing the mold burden in a home (Vesper 2010 , in press). United States Environmental Protection Agency (US EPA) and Department of Housing and Urban Development (HUD) researchers have developed a metric called the Environmental Relative Moldiness Index (ERMI) to objectively describe the home mold burden (Vesper et al. 2007). A DNA-based analysis called Mold Specific Quantitive PCR (MSQPCR) of 36 molds including, the 26 Group 1 species associated with homes with water damage and the 10 Group 2 species which are found in homes independent of water damage, forms the basis of the ERMI. (Figure 1, click once for values, click 2-5 times for quartiles) If the Sum of the Logs of the Group 2 (SLG2) molds is subtracted from the Sum of the Logs of the Group1 (SLG1) molds, a unit-less Environmental Relative Moldiness Index (ERMI) value is calculated which describes the mold burden in a home with a single numeric value relative to the National ERMI scale. The ERMI scale ranges from about -10 to 20 or even higher and is divided into quartiles. The homes in the lowest quartile have the lowest mold burden. Each higher quartile indicates more mold present in the home. The fourth quartile indicates homes with the highest mold burden (Vesper et al. 2007)

Literature references pertinent to this technology can be found at the end of this page.

Primers and Probes for Target Species

Absidia | Acremonium | Alternaria | Aspergillus | Aureobasidium | Candida | Chaetomium | Cladosporium | Emericella | Eurotium | Epicoccum | Fusarium | Geotrichum | Memnoniella | Mucor | Myrothecium | Paecilomyces | Penicillium | Rhizomucor | Rhizopus | Scopulariopsis | Stachybotrys | Trichoderma | Ulocladium | Wallemia | Universial Penicillium, Aspergillus, Paecilomyces |

Absidia corymbifera (assay name: Acory)
Forward Primer NS92F: 5'-CACCGCCCGTCGCTAC
Reverse Primer AcoryR1: 5'-GCAAAGCGTTCCGAAGGACA
Probe AcoryP1: 5'-ATGGCACGAGCAAGCATTAGGGACG

Acremonium strictum (assay name: Astrc)
Forward Primer AstrcF1: 5'-CAACCCATTGTGAACTTACCAAAC
Reverse Primer AstrcR1: 5'-CGCCCCTCAGAGAAATACGATT
Probe AstrcP1: 5'-TCAGCGCGCGGTGGCCTC

Alternaria alternata (assay name: Aaltr)
Forward Primer AaltrF1: 5'-GGCGGGCTGGAACCTC
Reverse Primer AltrR1-1: 5'-GCAATTACAAAAGGTTTATGTTTGTCGTA
Probe AaltrP1: 5'-TTACAGCCTTGCTGAATTATTCACCCTTGTCTTT

Aspergillus auricomus (assay name: Aauri)
Forward Primer AcircF1: 5'-ATTACTGAGTGAGGGTCCCTCG
Reverse Primer AauriR1: 5'-GGCGGCCGCGTAAAC
Probe AcircP1: 5'-CCCGCCGAAGCAACAAGGTACG

Aspergillus caespitosus (assay name: Acaes)
Forward Primer AcaesF1: 5'-CTCCCACCCGTGAATACCTT
Reverse Primer AcaesR1: 5'-GGCTCAGACGCAACTCTACAAT
Probe AcaesP1: 5'-CACTGTTGCTTCGGCGAGGAGCC

Aspergillus candidus (assay name: Acand3)
Forward Primer AcandF1: 5'-TTACCGAGTGAGGGTTTCTCTGA
Reverse Primer AcandR2: 5'-CCCGCCGAAGCAACAG
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Aspergillus carbonarius (assay name: Acarb)
Forward Primer AcarbF1-1: 5'-CTTTGGGCCCAACCTCCtAC
Reverse Primer AcarbR1: 5'-CCCGAGGGGCAGAGATG
Probe AspP1: 5'-TTGCTTCGGCGGGCCC

Aspergillus cervinus (assay name: Acerv)
Forward Primer AcervF1: 5'-CCACCCGTGCTATTGTACCTTT
Reverse Primer AcervR1-1: 5'-CAACTCAGACTGCAATTCAGAACtGT
Probe AspP1: 5'-TTGCTTCGGCGGGCCC

Aspergillus clavatus/giganteus (assay name: Aclav)
Forward Primer AclavF1: 5'-CCCGCCGTCTTCGGA
Reverse Primer AclavR1: 5'-CCGTTGTTGAAAGTTTTAACTGATTATG
Probe AfumiP1: 5'-CCCGCCGAAGACCCCAACATG

Aspergillus flavus/oryzae (assay name: Aflav)
Forward Primer AflavF1: 5'-CGAGTGTAGGGTTCCTAGCGA
Reverse Primer AflavR1: 5'-CCGGCGGCCATGAAT
Probe AflavP1: 5'-TCCCACCCGTGTTTACTGTACCTTAGTTGCT

Aspergillus fumigatus, Neosartorya fischeri (assay name: Afumi)
Forward Primer AfumiF1: 5'-GCCCGCCGTTTCGAC
Reverse Primer AfumiR1: 5'-CCGTTGTTGAAAGTTTTAACTGATTAC
Probe AfumiP1: 5'-CCCGCCGAAGACCCCAACATG

Aspergillus flavipes (assay name: Aflvp2)
Forward Primer AflvpF1: 5'-CCACCCGTGACTACTGTACCAC
Reverse Primer AflvpR2: 5'-AGGCTTTCAGAAACAGTGTTCG
Probe AspP1: 5'-TTGCTTCGGCGGGCCC

Aspergillus niger/awamori/foetidus/phoenicis (assay name: Anigr)
Forward Primer AnigrF1: 5'-GCCGGAGACCCCAACAC-3'
Reverse Primer AnigrR1: 5'-TGTTGAAAGTTTTAACTGATTGCATT-3'
Probe AnigrP1: 5'-AATCAACTCAGACTGCACGCTTTCAGACAG

Aspergillus niveus (assay name: Anive)
Forward Primer AniveF1: 5'-ACCCGTGCCTATTGTACCCT
Reverse Primer AniveR1: 5'-TGCAAACAATCACACTCAGACAC
Probe AspP1: 5'-TTGCTTCGGCGGGCCC

Aspergillus ochraceus/ostianus (assay name: Aochr1)
Forward Primer AochrF1: 5'-AACCTCCCACCCGTGTATACC-3'
Reverse Primer AochrR1: 5'-CCGGCGAGCGCTGTG-3'
Probe AochrP1: 5'-ACCTTGTTGCTTCGGCGAGCCC

Aspergillus paradoxus (assay name: Apard)
Forward Primer ApardF1: 5'-CGGGGGGCTTACGCT
Reverse Primer ApardR1-1: 5'-GACTGCAACTTCATACAGAGTTGGT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Aspergillus parasiticus/sojae (assay name: Apara)
Forward Primer AflavF1: 5'-CGAGTGTAGGGTTCCTAGCGA-3'
Reverse Primer AparaR3: 5'-GCCCGGGGCTGACG
Probe AflavP1: 5'-TCCCACCCGTGTTTACTGTACCTTAGTTGCT

Aspergillus penicillioides (assay name: Apeni2)
Forward Primer ApeniF2: 5'-CGCCGGAGACCTCAACC
Reverse Primer ApeniR2: 5'-TCCGTTGTTGAAAGTTTTAACGA
Probe ApeniP2: 5'-TGAACACTGTCTGAAGGTTGCAGTCTGAGTATG

Aspergillus puniceus (assay name: Apuni)
Forward Primer ApuniF1: 5'-CATTACCGAGTGCAGGCCTC
Reverse Primer AustsR1: 5'-GCCGAAGCAACGTTGGTC
Probe ApuniP1: 5'-CCCCACAGGCAGGCCTAACCTC

Aspergillus restrictus/caesillus/conicus (assay name: Arest)
Forward Primer ArestF1: 5'-GGGCCCGCCTTCAT-3'
Reverse Primer ArestR1: 5'-GTTGTTGAAAGTTTTAACGATTTTTCT
Probe ArestP1: 5'-CCCGCCGGAGACTCCAACATTG

Aspergillus sclerotiorum (assay name: Asclr)
Forward Primer AcircF1: 5'-ATTACTGAGTGAGGGTCCCTCG
Reverse Primer AsclrR1: 5'-CCTAGGGAGGGGGGTTTGA
Probe AcircP1: 5'-CCCGCCGAAGCAACAAGGTACG

Aspergillus sydowii (assay name: Asydo3)
Forward Primer AsydoF1-1: 5'-CAACCTCCCACCCGAGAA
Reverse Primer AversR1-1: 5'-CCATTGTTGAAAGTTTTGACTGATcTTA
Probe versP1: 5'-AGACTGCATCACTCTCAGGCATGAAGTTCAG

Aspergillus tamarii (assay name: Atama2)
Forward Primer AflavF1: 5'-CGAGTGTAGGGTTCCTAGCGA
Reverse Primer AtamaR2: 5'-CCCGGCGGCCTTAAAG
Probe AflavP1: 5'-TCCCACCCGTGTTTACTGTACCTTAGTTGCT

Aspergillus terreus (assay name: Aterr2)
Forward Primer AterrF1-1: 5'-ATCATTACCGAGTGCGTGTCTTTA
Reverse Primer AterrR2: 5'-CCCGCCGAAGCAACAAG
Probe AterrP2: 5'-CCCAACCTCCCACCCGTGACTATTG

Aspergillus unguis (assay name: Aungu)
Forward Primer AunguF1: 5'-CAACCTCCCACCCTTGAATACT
Reverse Primer AunguR1: 5'-TCACTCTCAGGCATGAAGTTCAG
Probe AcaesP1: 5'-CACTGTTGCTTCGGCGAGGAGCC

Aspergillus ustus (assay name: Austs2)
Forward Primer AustsF2-1: 5'-AAGGATCATTACCGAGTGCAtGT
Reverse Primer AustsR1: 5'-GCCGAAGCAACGTTGGTC
Probe AustsP1: 5'-CCCCCGGGCAGGCCTAACC

Aspergillus versicolor (assay name: Avers2-2)
Forward Primer AversF2 (5x): 5'-CGGCGGGGAGCCCT
Reverse Primer AversR1-1: 5'-CCATTGTTGAAAGTTTTGACTGATcTTA
Probe versP1: 5'-AGACTGCATCACTCTCAGGCATGAAGTTCAG

Aspergillus wentii (assay name: Awent)
Forward Primer AwentF1: 5'-CATTACCGAGTGAGGACCTAACC
Reverse Primer AwentR1: 5'-CGGCGGCCACGAAT
Probe AcircP1: 5'-CCCGCCGAAGCAACAAGGTACG

Aureobasidium pullulans (assay name: Apull)
Forward Primer ApullF1: 5'-GATCATTAAAGAGTAAGGGTGCTCA
Reverse Primer ApullR1: 5'-GCTCGCCTGGGACGAATC
Probe ApullP1: 5'-CGCCCGACCTCCAACCCTTTG

Candida albicans (assay name: Calbi)
Forward Primer CalbF1: 5'-CTTGGTATTTTGCATGTTGCTCTC
Reverse Primer CalbR1: 5'-GTCAGAGGCTATAACACACAGCAG
Probe CalbP1: 5'-TTTACCGGGCCAGCATCGGTTT

Candida dubliniensis (assay name: Cdubl)
Forward Primer CdubF1: 5'-AGATCAGACTTGGTATTTTGCAAGTTA
Reverse Primer CdubR1: 5'-TAGGCTGGCAGTATCGTCAGA
Probe CdubP1: 5'-TTTACCGGGCCAGCATCGGTTT

Candida glabrata (assay name: Cglab)
Forward Primer Cglab F1: 5'-GCGCCCCTTGCCTCTC
Reverse Primer Cglab R1: 5'-CCCAGGGCTATAACACTCTACACC
Probe Cglab P1: 5'-TGGGCTTGGGACTCTCGCAGC

Candida (assay name: Pichia) guilliermondii (assay name: Cguil)
Forward Primer CguiF1: 5'-CCTTCGTGGCGGGGTG
Reverse Primer CguiR1: 5'-GCAGGCAGCATCAACGC
Probe CguiP1: 5'-CCGCAGCTTATCGGGCCAGC

Candida haemulonii, svar. 1 (assay name: Chaem1)
Forward Primer ChaeF1: 5'-GGAGCGACAACGAGCAGTC
Reverse Primer ChaeR1: 5'-AGGAGCCAGAAAGCAAGACG
Probe ChaeP1: 5'-ATGTAGTACAGCCCTCTGGGCTGTGCA

Candida haemulonii, svar. 2 (assay name: Chaem2)
Forward Primer Cha2F1: 5'-ATCGGGTGGAGCGGAACT
Reverse Primer Cha2R1: 5'-CGAAGCAGGAACCATCTGAGA
Probe Cha2P1: 5'-AAGTGGGAGCTGATGTAGCAACCCCC

Candida krusei (assay name: Ckrus)
Forward Primer CkruF1: 5'-CTCAGATTTGAAATCGTGCTTTG
Reverse Primer CkruR1: 5'-GGGGCTCTCACCCTCCTG
Probe CkruP1: 5'-CACGAGTTGTAGATTGCAGGTTGGAGTCTG

Candida lipolytica (assay name: Clipo)
Forward Primer ClipF1: 5'-TAGCGAGACGAGGGTTACAAATG
Reverse Primer ClipR1: 5'-CGTCGGTGGCAGTGTGGA
Probe ClipP1: 5'-CCTTCGGGCGTTCTCCCCTAACC

Candida lusitaniae (assay name: Clusi)
Forward Primer Clus F2: 5'-GGGAATTGTAATTTGAAGGTTTCGT-3'
Reverse Primer Clus R2: 5'-GTCGGCGTGCGCCATA-3'
Probe Clus P2: 5'-TCTGAGTCGGCCGCGCCC-3'

Candida maltosa (assay name: Cmalt)
Forward Primer CmalF1: 5'-GGCCAGCATCAGTTTGGAC
Reverse Primer CmalR1: 5'-TCTAGACTGGCAGTATCGACAGTG
Probe CmalP1: 5'-TAGGACAATTGCGGTGGAATGTGGC

Candida parapsilosis (assay name: Cpara)
Forward Primer CparF1: 5'-GATCAGACTTGGTATTTTGTATGTTACTCTC
Reverse Primer CparR1: 5'-CAGAGCCACATTTCTTTGCAC
Probe CparP1: 5'-CCTCTACAGTTTACCGGGCCAGCATCA

Candida sojae (assay name: Csoja)
Forward Primer CsojF1: 5'-CGGTTGTGTGTTATAGCCTTCGTA
Reverse Primer CsojR1: 5'-ATCATTATGCCAACATCCTAGGTAAT
Probe CtropP2: 5'-CGCAGTCCTCAGTCTAGGCTGGCAG

Candida tropicalis (assay name: Ctrop)
Forward Primer CtropF1: 5'-GCGGTAGGAGAATTGCGTT
Reverse Primer CtropR2: 5'-TCATTATGCCAACATCCTAGGTTTA
Probe CtropP2: 5'-CGCAGTCCTCAGTCTAGGCTGGCAG

Candida viswanathii (assay name: Cvisw)
Forward Primer CvisF1: 5'-CGGCAGGACAATCGCGT
Reverse Primer CvisR1: 5'-TCTAGGCTGGCAGTATCCACG
Probe CvisP1: 5'-AATGTGGCACGGCCTCGGC

Candida zeylanoides (assay name: Czeyl)
Forward Primer Czey F1: 5'-GTTGTAATTTGAAGAAGGTAACTTTGATT
Reverse Primer Czey R1: 5'-GACTCTTCGAAAGCACTTTACATGG
Probe Czey P1: 5'-CCTTGGAACAGGACGTCACAGAGGGT

Chaetomium globosum (assay name: Cglob)
Forward Primer CglobF1: 5'-CCGCAGGCCCTGAAAAG
Reverse Primer CglobR1: 5'-CGCGGCGCGACCA
Probe CglobP1: 5'-AGATGTATGCTACTACGCTCGGTGCGACAG

Cladosporium cladosporioides, svar. 1 (assay name: Cclad1)
Forward Primer Cclad1F1: 5'-CATTACAAGTGACCCCGGTCTAAC
Reverse Primer CcladR1: 5'-CCCCGGAGGCAACAGAG
Probe CcladP1: 5'-CCGGGATGTTCATAACCCTTTGTTGTCC

Cladosporium cladosporioides, svar. 2 (assay name: Cclad2)
Forward Primer Cclad2F1: 5'-TACAAGTGACCCCGGCTACG
Reverse Primer CcladR1: 5'-CCCCGGAGGCAACAGAG
Probe CcladP1: 5'-CCGGGATGTTCATAACCCTTTGTTGTCC

Cladosporium herbarum (assay name: Cherb)
Forward Primer CherbF1: 5'-AAGAACGCCCGGGCTT
Reverse Primer CherbR1: 5'-CGCAAGAGTTTGAAGTGTCCAC
Probe CherbP1: 5'-CTGGTTATTCATAACCCTTTGTTGTCCGACTCTG

Cladosporium sphaerospermum (assay name: Cspha)
Forward Primer CsphaF1: 5'-ACCGGCTGGGTCTTTCG
Reverse Primer CsphaR1: 5'-GGGGTTGTTTTACGGCGTG
Probe CsphaP1: 5'-CCCGCGGCACCCTTTAGCGA

Emericella (Aspergillus) nidulans/rugulosa/quadrilineata (assay name: Anidu2)
Forward Primer AversF1: 5'-CAACCTCCCACCCGTGAC
Reverse Primer AniduR1-1: 5'-CCATTGTTGAAAGTTTTGACTGATaTGT
Probe versP1: 5'-AGACTGCATCACTCTCAGGCATGAAGTTCAG

Emericella (Aspergillus) variecolor (assay name: Avari)
Forward Primer AversF2: 5'-CGGCGGGGAGCCCT
Reverse Primer AvariR1-1: 5'-CCATTGTTGAAAGTTTTGACTAAATTCTC
Probe AvariP1: 5'-CATCACTACAGGCATGAAGTTCGGTGGT

Eurotium (Aspergillus) amstelodami/chevalieri/herbariorum/rubrum/repens (assay name: Eamst)
Forward Primer EamstF1: 5'-GTGGCGGCACCATGTCT
Reverse Primer EamstR1: 5'-CTGGTTAAAAAGATTGGTTGCGA
Probe EamstP1: 5'-CAGCTGGACCTACGGGAGCGGG

Epicoccum nigrum (assay name: Enigr)
Forward Primer EnigrF1: 5'-TTGTAGACTTCGGTCTGCTACCTCTT
Reverse Primer EnigrR1: 5'-TGCAACTGCAAAGGGTTTGAAT
Probe EnigrP1: 5'-CATGTCTTTTGAGTACCTTCGTTTCCTCGGC

Fusarium solani f.sp. batatas MP II (Fsola2)
Forward Primer FsolaF2: 5'-CGCCGCAGCTTCCAAT
Reverse Primer FsolaR2: 5'-GATTCGAGGTCAACGTTCTAAAAGT
Probe* FsolaP1mgb: 5'-CGTAGTAGCTAACACCTC

Fusarium solani f.sp. cucurbitae MP I (Fsola1)
Forward Primer FsolaF1: 5'-CAGCCGCAGCTTCCAGT
Reverse Primer FsolaR1-1: 5'-CGTGGCCGAGCCtCTG
Probe* FsolaP1mgb: 5'-CGTAGTAGCTAACACCTC

Fusarium solani f.sp. mori MP III, Fusarium solani f.sp. cucurbitae MP V, Fusarium solani f.sp. pisi MP VI, Fusarium solani f.sp. robiniae MP VII (Fsola3)
Forward Primer FsolaF3: 5'-CGCCGCAGCTTCCATC
Reverse Primer FsolaR3: 5'-GATTCGAGGTCAACTTCAGAAGAG
Probe* FsolaP1mgb: 5'-CGTAGTAGCTAACACCTC

Fusarium solani f.sp. xanthoxyli MP IV (Fsola4)
Forward Primer FsolaF4: 5'-CGCCGCAGCTTCCATT
Reverse Primer FsolaR4-1: 5'-GATTCGAGGTCAACTTTCAGAtGT
Probe* FsolaP1mgb: 5'-CGTAGTAGCTAACACCTC

Geotrichum candidum strain UAMH 7863 (assay name: Geo - reference strain only)
Forward Primer GeoF1: 5'-GATATTTCTTGTGAATTGCAGAAGTGA
Reverse Primer GeoR1: 5'-TTGATTCGAAATTTTAGAAGAGCAAA
Probe GeoP1: 5'-CAATTCCAAGAGAGAAACAACGCTCAAACAAG

Geotrichum candidum (assay name: Gcand2)
Forward Primer NS92F: 5'-CACCGCCCGTCGCTAC
Reverse Primer GcandR1: 5'-AGAAAAGTTGCCCTCTCCAGTT
Probe GeoP2: 5'-TCAATCCGGAAGCCTCACTAAGCCATT

Geotrichum klebahnii (assay name: Gkleb1)
Forward Primer GklebF1: 5'-GGGCGACTTTTCCGGC
Reverse Primer GklebR2: 5'-TGGCACAAATTCTCCTCTAATTTATTTA
Probe GklebP1: 5'-AAGCTAGTCAAACTTGGTCATTTAGAGGAAGTAAAAGTC

Memnoniella echinata (assay name: Mem)
Forward Primer StacF4 5'-TCCCAAACCCTTATGTGAACC
Reverse Primer MemR1: 5'-TGTTTATACCACTCAGACGATACTCAAGT
Probe MemP1: 5'-CTCGGGCCCGGAGTCAGGC

Mucor amphibiorum/circinelloides/hiemalis/indicus/mucedo/racemosus/ramosissimus
and Rhizopus azygosporus/homothalicus/microsporus/oligosporus/oryzae (assay name: Muc1)
Forward Primer NS92F: 5'-CACCGCCCGTCGCTAC
Reverse Primer MucR1-1: 5'-CCTAGTTTGCCATAGTTCTCAGCAG
Probe MucP1: 5'-CCGATTGAATGGTTATAGTGAGCATATGGGATC

Myrothecium verrucaria (assay name: Mverr)
Forward Primer MyroF1: 5'-AGTTTACAAACTCCCAAACCCTTT
Reverse Primer MyroR1: 5'-GTGTCACTCAGAGGAGAAAACCA
Probe MyroP1: 5'-CGCCTGGTTCCGGGCCC

Paecilomyces lilacinus (assay name: Plila)
Forward Primer PlilaF1: 5'-CCCACTGTGAACCTTACCTCAG
Reverse Primer PlilaR1: 5'-GCTTGTGCAACTCAGAGAAGAAAT
Probe PlilaP1: 5'-CCGCCCGCTGGGCGTAATG

Paecilomyces variotii (assay name: Pvari2)
Forward Primer PvariF2: 5'-CGAAGACCCCTGGAACG
Reverse Primer PvariR1: 5'-GTTGTTGAAAGTTTTAATTGATTGATTGT
Probe PvariP1: 5'-CTCAGACGGCAACCTTCCAGGCA

Penicillium aethiopicum (assay name: Paeth)
Forward Primer PaethF1-1: 5'-CGGGGGGCTCtCGCT
Reverse Primer PchryR1-1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGAgTA
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium atramentosum (assay name: Patra)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PatraR1: 5'-CCCCGGCGGCCATA
Probe PenP3: 5'-TCCAACCTCCCACCCGTGTTTATTT

Penicillium aurantiogriseum/freii/polonicum/tricolor/viridicatum (assay name: PenGrp1A)
Forward Primer PexpaF1-1: 5'-TTACCGAGTGAGGGCCgTT
Reverse Primer PauraR6: 5'-CCCGGCGGCCAGTA
Probe PenP3: 5'-TCCAACCTCCCACCCGTGTTTATTT

Penicillium aurantiogriseum/freii/hirsutum/polonicum/tricolor/viridicatum/verrucosum, svar. 2 (assay name: PenGrp1)
Forward Primer PauraF1: 5'-CGGGCCCGCCTTTAC
Reverse Primer PauraR1-1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium brevicompactum/stoloniferum (assay name: Pbrev)
Forward Primer PbrevF3: 5'-GGCGAGCCTGCCTTTTG
Reverse Primer PenR2: 5'-GATCCGTTGTTGAAAGTTTTAAATAATTTATA
Probe PbrevP2: 5'-CTCGCCGAAGACACCTTAGAACTCTGTCTGA

Penicillium canescens (assay name: Pcane2)
Forward Primer PcaneF1: 5'-TTACCGAGCGAGAATTCTCTGA
Reverse Primer PcaneR2-1: 5'-CCGCCGAAGCAACAAGtTAC
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Penicillium chrysogenum, svar. 2 (assay name: Pchry)
Forward Primer PchryF4-1: 5'-GCCTGTCCGAGCGTCACTT
Reverse Primer PchryR8: 5'-CCCCCGGGATCGGAG
Probe PenP6: 5'-CCAACACACAAGCCGTGCTTGAGG

Penicillium chrysogenum/griseofulvum/glandicola/coprophilum/expansum
and Eupenicillium crustaceum/egyptiacum (assay name: PenGrp3)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC
Reverse Primer PchryR1-1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTA
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium citreonigrum (Pcteo2)
Forward Primer PcteoF2-1: 5'-GGGGGCATCTGCtCTCTG
Reverse Primer PcteoR2-1: 5'-CCGTTGTTGAAAGTTTTAAGTTATcTAA
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Penicillium citrinum/sartoryi/westlingi (Pcitr)
Forward Primer PcitrF1: 5'-CCGTGTTGCCCGAACCTA
Reverse Primer PcitrR1: 5'-TTGTTGAAAGTTTTAACTAATTTCGTTATAG
Probe PcitrP1: 5'-TGCAACTTCAGACAGCGTTCAGGGG

Penicillium coprophilum (assay name: Pcopr)
Forward Primer PcoprF1-1: 5'-GGGTCCAACCTCCCACtCA
Reverse Primer PchryR1-1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGAgTA
Probe PenP1: 5'-CGCCTTAACTGGCCGCCGG

Penicillium corylophilum (assay name: Pcory)
Forward Primer PcoryF1: 5'-GTCCAACCTCCCACCCA
Reverse Primer PcoryR3-1: 5'-GCTCAGACTGCAATCTTCAGACTGT
Probe PcoryP1: 5'-CTGCCCTCTGGCCCGCG

Penicillium crustosum/camembertii/commune/echinulatum/solitum (assay name: PenGrp2)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC
Reverse Primer PauraR1-1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium decumbens (assay name: Pdecu3)
Forward Primer PdecuF3: 5'-GGCCTCCGTCCTCCTTTG
Reverse Primer PdecuR4-1: 5'- GACCTACAGAGCGGGTGATGA
Probe PenP7: 5'-CCGAAAGGCAGCGGCGGC

Penicillium digitatum (assay name: Pdigi)
Forward Primer PaethF1-1: 5'-CGGGGGGCTCtCGCT
Reverse Primer PdigiR1: 5'-CGTTGTTGAAAGTTTTAAATAATTTCGT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium expansum (assay name: Pexpa)
Forward Primer PexpaF1-1: 5'-TTACCGAGTGAGGGCCgTT
Reverse Primer PexpaR2-1: 5'-GCCCGCCGAAGCtACG
Probe PenP3: 5'-TCCAACCTCCCACCCGTGTTTATTT

Penicillium fellutanum/charlesii (assay name: Pfell2)
Forward Primer PfellF2: 5'- CTGAGTGCGGGCCCTCT
Reverse Primer PfellR2: 5'- CGCCGAAGCAACACTGTAAG
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Penicillium glandicola (assay name: Pglan)
Forward Primer PglanF1-1: 5'-CCGGGGGGCTTtCGT
Reverse Primer PchryR1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGACTA
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium griseofulvum (assay name: Pgris)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PchryR6: 5'-CCCGGCGGCCAGTT
Probe PenP3: 5'-TCCAACCTCCCACCCGTGTTTATTT

Penicillium implicatum (assay name: Pimpl)
Forward Primer PimplF1: 5'-GCCGAAGACCCCCCTGT
Reverse Primer PimplR1: 5'CGTTGTTGAAAGTTTTGACTGATTGT
Probe PimplP1: 5'-AACGCTGTCTGAAGCTTGCAGTCTGAGC

Penicillium islandicum (assay name: Pisla)
Forward Primer PislaF1: 5'-CGAGTGCGGGTTCGACA
Reverse Primer PislaR1: 5'-GGCAACGCGGTAACGGTAG
Probe PislaP1: 5'-AGCCCAACCTCCCACCCGTG

Penicillium italicum (assay name: Pital)
Forward Primer PitalF1-1: 5'-CTCCCACCCGTGTTTATTTAtCA
Reverse Primer PexpaR1: 5'-TCACTCAGACGACAATCTTCAGG
Probe PenP1: 5'-CGCCTTAACTGGCCGCCGG

Penicillium melinii (assay name: Pmeli)
Forward Primer PmeliF1-1: 5'-CACGGCTTGTGTGTTGGtCT
Reverse Primer PmeliR1: 5'-GGGCCTACAAGAGCGGAA
Probe PenP7: 5'-CCGAAAGGCAGCGGCGGC

Penicillium miczynskii (assay name: Pmicz)
Forward Primer PmiczF1-1: 5'-GTGTTTAACGAACCTTGTTGCaTT
Reverse Primer PmiczR1-1: 5'-CTCAGACTGCATACTTCAGACaGA
Probe PsimpP1: 5'-CCGCCTCACGGCCGCC

Penicillium olsonii (assay name: Polsn)
Forward Primer PolsnF1: 5'-GGCGAGCCTGCCTTCG
Reverse Primer PenR2: 5'-GATCCGTTGTTGAAAGTTTTAAATAATTTATA
Probe PolsnP2: 5'-TCCGCGCTCGCCGGAGAC

Penicillium oxalicum (assay name: Poxal)
Forward Primer PoxalF1: 5'-GGGCCCGCCTCACG
Reverse Primer PoxalR1: 5'-GTTGTTGAAAGTTTTAACTGATTTAGTCAAGTA
Probe PoxalP1: 5'-ACAAGAGTTCGTTTGTGTGTCTTCGGCG

Penicillium purpurogenum (assay name: Ppurp)
Forward Primer PpurpF1: 5'-AGGATCATTACTGAGTGCGGA
Reverse Primer PpurpR1: 5'-GCCAAAGCAACAGGGTATTC
Probe PpurpP1: 5'-CCCTCGCGGGTCCAACCTCC

Penicillium raistrickii (assay name: Prais3)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PraisR2: 5'-CCGGCGGCCTGACG
Probe PenP3: 5'-TCCAACCTCCCACCCGTGTTTATTT

Penicillium restrictum (assay name: Prest2)
Forward Primer PrestF2-1: 5'-CACGGCTTGTGTGTTGGtCCT
Reverse Primer PrestR1-1: 5'-CGGCCGGGCCTaCAA
Probe PenP7: 5'-CCGAAAGGCAGCGGCGGC

Penicillium roquefortii (assay name: Proqu)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC
Reverse Primer ProquR2: 5'-TTAAATAATTTATATTTGTTCTCAGACTGCAT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Penicillium sclerotiorum (assay name: Psclr)
Forward Primer PsclrF1: 5'-TTCCCCCGGGAACAGG
Reverse Primer PsclrR1: 5'-GCCCCATACGCTCGAGGAT
Probe PsclrP1: 5'-CCGAAAGGCAGTGGCGGCAC

Penicillium simplicissimum/ochrochloron (assay name: Psimp2)
Forward Primer PsimpF2-1: 5'-CGCCGAAGACACCATTGAtCT
Reverse Primer PsimpR4-1: 5'-CTGAATTCTGCAATTCACATaACG
Probe PsimpP2: 5'-TGTCTGAAGATTGCAGTCTGAGCGATTAGC

Penicillium glabrum/lividum/pupurescens/spinulosum/thomii (assay name: Pspin2)
Forward Primer PspinF2: 5'-CATTACTGAGTGAGGGCCCTCT
Reverse Primer PspinR2-1: 5'-CGTGAGGCGGGaGCA
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Penicillium variabile (assay name: Pvarb2)
Forward Primer PvarbF2-1: 5'-TTACCGAGTGCGGGTTCtAA
Reverse Primer PvarbR2: 5'-CGAGGCAACGCGGTAAC
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

Penicillium verrucosum, svar. 1 (assay name: Pverr)
Forward Primer PverrF2: 5'-CGGGCCCGCCTTTG
Reverse Primer PauraR1: 5'-GAAAGTTTTAAATAATTTATATTTTCACTCAGACTT
Probe PenP2: 5'-CGCGCCCGCCGAAGACA

Rhizomucor meihei/pusillus/variabilis (assay name: Rmuc)
Forward Primer NS92F: 5'-CACCGCCCGTCGCTAC
Reverse Primer RmucR1: 5'-GTAGTTTGCCATAGTTCGGCTA
Probe RmucP1: 5'-TTGAATGGCTATAGTGAGCATATGGGAGGCT

Rhizopus stolonifer (assay name: Rstol)
Forward Primer NS92F: 5'-CACCGCCCGTCGCTAC
Reverse Primer RstolR1: 5'-GCTTAGTTTGCCATAGTTCTCTAACAA
Probe MucP1: 5'-CCGATTGAATGGTTATAGTGAGCATATGGGATC

Scopulariopsis asperula (assay name: SCaspr)
Forward Primer SCbrvF1: 5'-CCCCTGCGTAGTAGATCCTACAT
Reverse Primer SCasprR1: 5'-TCCGAGGTCAAACCATGAGTAA
Probe ScopP1: 5'-TCGCATCGGGTCCCGGCG

Scopulariopsis brevicaulis/fusca (assay name: SCbrv)
Forward Primer SCbrvF1: 5'-CCCCTGCGTAGTAGATCCTACAT
Reverse Primer SCbrvR1: 5'-TCCGAGGTCAAACCATGAAATA
Probe ScopP1: 5'-TCGCATCGGGTCCCGGCG

Scopulariopsis brumptii (assay name: SCbrm)
Forward Primer SCbrmF1: 5'-CCCCTGCGTAGTAGTAAAACCA
Reverse Primer SCbrmR1: 5'-CCGAGGTCAAACATCTTTGG
Probe ScopP1: 5'-TCGCATCGGGTCCCGGCG

Scopulariopsis chartarum (assay name: SCchr)
Forward Primer SCchrF1: 5'-CCCCCTGCGTAGTAGTAAAGC
Reverse Primer SCchrR1: 5'-TCCGAGGTCAAACCATCAAG
Probe ScopP1: 5'-TCGCATCGGGTCCCGGCG

Scopulariopsis sphaerospora (assay name: SCsph)
Forward Primer SCsphF1: 5'-CCCCCTGCGTAGTAGTTTACAA
Reverse Primer SCsphR1: 5'-CCGAGGTCAAACCATCAAAAG
Probe ScopP1: 5'-TCGCATCGGGTCCCGGCG

Stachybotrys chartarum (assay name: Stac)
Forward Primer StacF4: 5'-TCCCAAACCCTTATGTGAACC
Reverse Primer StacR5: 5'-GTTTGCCACTCAGAGAATACTGAAA
Probe StacP2: 5'-CTGCGCCCGGATCCAGGC

Trichoderma asperellum/hamatum (assay name: Taspr1)
Forward Primer TasprF1: 5'-CCCAAACCCAATGTGAACGT
Reverse Primer TasprR2-1: 5'-GGACTACAGAAAGAGTTTGGTTGCTT
Probe TridP1: 5'-CCAAACTGTTGCCTCGGCGGG

Trichoderma harzianum (assay name: Tharz)
Forward Primer TharzF1: 5'-TTGCCTCGGCGGGAT
Reverse Primer TharzR1: 5'-ATTTTCGAAACGCCTACGAGA
Probe TharzP1: 5'-CTGCCCCGGGTGCGTCG

Trichoderma longibrachiatum/citrinoviride (assay name: Tlong)
Forward Primer TlongF1: 5'-TGCCTCGGCGGGATTC
Reverse Primer TlongR1: 5'-CGAGAAAGGCTCAGAGCAAAAAT
Probe TlongP1: 5'-TCGCAGCCCCGGATCCCA

Trichoderma viride/atroviride/koningii (assay name: Tviri)
Forward Primer TviriF1: 5'-CCCAAACCCAATGTGAACCA
Reverse Primer TviriR1: 5'-TCCGCGAGGGGACTACAG
Probe TridP1: 5'-CCAAACTGTTGCCTCGGCGGG

Ulocladium atrum (assay name: Uatrm)
Forward Primer UatrmF2: 5'-CGGGCTGGCATCCTTC
Reverse Primer UatrmR2: 5'-CTGATTGCAATTACAAAAGGTTTATG
Probe UloP1: 5'-TGAATTATTCACCCGTGTCTTTTGCGTACTTCT

Ulocladium botrytis (assay name: Ubotr)
Forward Primer UbotrF1: 5'-CCCCCAGCAGTGCGTT
Reverse Primer UbotrR1: 5'-CTGATTGCAATTACAAAAGGTTTATG
Probe UloP1: 5'-TGAATTATTCACCCGTGTCTTTTGCGTACTTCT

Ulocladium chartarum (assay name: Uchar)
Forward Primer UcharF1-1: 5'-AGCGGGCTGGAATCCaTT
Reverse Primer UcharR1-1: 5'-CTGATTGCAATTACAAAAGGTTgAAT
Probe UloP1: 5'-TGAATTATTCACCCGTGTCTTTTGCGTACTTCT

Wallemia sebi (assay name: Wsebi)
Forward Primer WsebiF1: 5'-GGCTTAGTGAATCCTTCGGAG
Reverse Primer WsebiR1: 5'-GTTTACCCAACTTTGCAGTCCA
Probe WsebiP1: 5'-TGTGCCGTTGCCGGCTCAAATAG

Universal Penicillium, Aspergillus and Paecilomyces varioti (assay name: PenAsp1mgb)
Forward Primer PenAspF1: 5'-CGGAAGGATCATTACTGAGTG
Reverse Primer PenAspR1: 5'-GCCCGCCGAAGCAAC
Probe* PenAspP1mgb: 5'-CCAACCTCCCACCCGTG

* Applied Biosystems MGB probe, labeled with 6FAM reporter and black hole quencher. Suggest labeling of all other probes with 6FAM reporter and TAMRA or black hole quencher.

Suggested probe and primer concentrations for all assays is 80 nM probe, 1000 nM primers. Primers with (5x) designations indicate suggested use of 5x higher concentration.

Lower case letters in primer sequences denote deliberate mismatches with target sequences.

Environmental Relative Moldiness Index (ERMI) Research Tool (Fact Sheet)

 

RECENT PUBLICATIONS (Present - 1999)

Bolanos-Rosero B., Betancourt D., Dean T. and Vesper S. Pilot study of mold populations inside and outside of Puerto Rican residences. Aerobiologia 29(4):537-543. 2013.

Reponen T., Levin L., Zheng S. Vesper S., Ryan P., Grinspun S.A. and LeMasters G. Family and home characteristics correlate with mold in homes. Environmental Research 124:67-70. 2013.

Johansson E., Reponen T., Vesper S., Levin L., Lockey J., Ryan P., Bernstein D.I., Villareal M., Hershey G.K.K., Schaffer C. and LeMasters G. Microbial content of household dust associated with exhaled NO in asthmatic children. Environment International 59:141-147. 2013.

Kettleson E., Kumar S., Reponen T., Vesper S., Meheust D., Grinspun S. and Adhikari A. Stenotrophomonas, Mycobacterium and Streptomyces in home dust and air: associations with moldiness and other home/family characteristics. Indoor Air 23(5):387-396. 2013.

Meheust D., Le Cann P., Reponen P., Wakefield J., Vesper S. and Gangneux J-P. Possible application of the Environmental Relative Moldiness Index in France: a pilot study in Brittany. International Journal of Hygiene and Environmental Health 216:333-340. 2013.

Vesper S., Barnes C., Ciaccio C.E., Cox D., Dewalt G., Jacobs D.E., Johanns A., Kennedy K.,Nunez-Alvarez A., Sandel M.T. and Ashley P. Higher Environmental Relative Moldiness Index (ERMI) values measured in homes of asthmatic children in Boston, Kansas City and San Diego. Journal of Asthma 50:155-161. 2013.

Blanc P.B., Quinlan P.J., Katz P.P., Balmes J.R., Trupin L., Cisternas M., Wymer J. and Vesper S.J. Higher EnvironmentalEnvironmental Relative Moldiness Index values measured in homes of adult asthmatics. Environmenal Research 122:98-101. 2013.

Nonnenmann M., Coronado G., Thompson B., Griffith W., Vesper S. and Faustman E. Utilizing pyrosequencing and quantitative PCR to characterize fungal populations in house dust samples. Journal of Environmental Monitoring 14:2038-2043. 2012.

Meheust D., Gangneux J-P, Reponen T., Wymer L., Vesper S., and LeCann P. Correlation between Environmental Relative Moldiness Index (ERMI) values in French dwellings and other measures of fungal contamination. Science of the Total Environment 438:319-324. 2012.

Thomas T.G., Burton N., Mueller N.C., Page E. and Vesper S. Comparison of work-related symtoms and visual contrast sensitivity between employees at a severely water-damaged school and a school without significant water damage. American Journal of Industrial Medicine 55:844-854. 2012.

Reponen T., Lockey J., Berstein D.I., Vesper S.J., Levin L., Zheng S., Ryan P., Grinspun S.A., Villareal M., Hershey G.K.K. and LeMasters G. Infant origins of childhood asthma associated with specific molds. Journal of Allergy and Clinical Immunology 130:639-644. 2012.

Murr A.H., Goldberg A.N., Pletcher S.D., Dillehay K., Wymer L.J. and Vesper S.J. Some CRS patients have elevated populations of fungi in their sinuses. The Laryngoscope 122:1438-1445. 2012.

Nayak A.P., Green B.J., Schmechel D., Janotka E., Vesper S.J. and Beezhold D.H. Monoclonal antibodies to hyphal exoantigens derived from the opportunistic pathogen, Aspergillus terreus. Journal of Clinical and Vaccine Immunology 18:1568-1576. 2011.

Reponen T., Vesper S., Levin L., Johansson E., Ryan P., Burkle J., Grinspun S.A., Zheng S., Berstein D.I., Lockey J., Villareal M., Hershey G.K.K. and LeMasters G. High Environmental Relative Moldiness Index during infancy as a predictor of age seven asthma. Annals of Allergy, Asthma and Immunology 107:120-126. 2011.

Johansson E., Reponen T., Vesper S., Levin L., Burkle J., Ryan P., Grinspun G.A., Zheng S., Hershey G.K.K., Bernstein D.I., Lockey J. and LeMasters G. Streptomycetes in house dust: associations with housing characteristics and endotoxin. Indoor Air 21:300-310. 2011.

Lin K-T., Schrantz M., Sandagdorj O., Keng Y-F., Boothe G. and Vesper S. Comparison of mold concentrations quantified by MSQPCR in air and dust samples versus spore trap analysis. Frontiers in BioScience 3:108-114. 2011.

Vesper S., Wakefield J., Ashley P., Cox D., Dewalt G., Friedman W. Geographic Distribution of Environmental Relative Moldiness Index (ERMI) molds in U.S. Homes. Journal of Environmnetal and Public Health. 2011. doi:10.1155/2011/242457.

Vesper S. Traditional mould analysis compared to a DNA-based method of mould analysis. Critical Reviews in Microbiology 37:15-24. 2011.

Nayak A.P., Green B.J., Janotka E., Blachere F.M., Vesper S.J., Beezhold D.H. and Schmechel D. Production and Characterization of IgM monoclinical antibodies against hyphal antigens of Stachybotrys species. Hybridoma 30:29-36. 2011.

Reponen T., Singh U., Schaffer C., Vesper S., Johansson E., Adhikari A., Grinspun S.A., Indugula R., Ryan P., Levin L. and Lemasters G. Visually observed mold and moldy odor versus quantitatively measured microbial exposure in homes. Science of Total Environment 408:5565-5574. 2010.

Ward, M.D., Donohue, M.J., Chung, Y.J., Coeland, L., Shoemaker, J.A., Vesper S.J., Selgrade, M.K. Human serum IgE reacts with a Metarhizium anisopliae fungal catalase. International Archives of Allergy and Immunology. 150:343-351. 2009.

Vesper, S., McKinstry, C., Cox, D., Dewalt, G. Correlaton between ERMI values and other moisture and mold assessments of homes in the American Healthy Homes Survey. Journal of Urban Health 86:850-860. 2009.

Yap, J., Toh, Z.A., Goh, V., Ng, L.C., Vesper, S. Assessment of mould concentrations in Singapore shopping centers using Mould Specific Quantitative PCR (MSQPCR) analysis. Indian Journal of Microbiology 49:290-293. 2009.

Vesper, S.J., McKinstry, C., Bradham, K.D., Ashley,P., Cox, D., Dewalt, G., Lin, K-T. Screening tools to estimate mold burdens in homes. Journal of Occupational and Environmental Medicine 51:80-86. 2009.

Vesper SJ, Wong W, Kuo M, Pierson DL. Mold species in dust from the International Space Station identified and quantified by mold specific quantitative PCR. Research in Microbiology. 159:432-435. 2008.

Iossifova Y, Reponen T, Sucharew H, Succop P, Vesper S. Use of (1-3)-ß-D-glucan concentrations in dust as a surrogate method for estimating specific mold exposures. Journal of Environmental Monitoring. 18:225-232. 2008.

Vesper S, McKinstry C, Haugland R, Neas L, Hudgens E, Heidenfelder B, Gallagher J. Higher Environmental Relative Moldiness Index (ERMIsm) values measured in Detroit homes of severely asthmatic children.. Science of the Total Environment. 394:192-196. 2008.

Vesper S, McKinstry C, Hartmann C, Neace M, Yoder S, Vesper A. Quantifying Fungal Viability in Air and Water Samples using Quantitative PCR after Treatment with Propidium Monoazide (PMA). Journal of Microbiological Methods. 72:180-184. 2008.

Vesper SJ, McKinstry C, Ashley P, Haugland RA, Yeatts K, Bradham K, Svendsen E. Quantitative PCR Analysis of molds in the dust from homes of asthmatic children in North Carolina. Journal of Environmental Monitoring. 9:826-830. 2007.

Vesper SJ, McKinstry C, Haugland RA, Wymer L, Ashley P, Cox D, DeWalt G, Friedman W. Development of an environmental relative moldiness index for homes in the U.S. Journal of Occupational and Environmental Medicine. 49:829-833. 2007

Meklin T, Reponen T, McKinstry C, Cho S-H, Grinshpun SA, Nevalainen A, Vepsäläinen A, Haugland RA, LeMasters G, Vesper SJ. Comparison of mold concentrations in indoor and outdoor air sampled simultaneously and quantified by MSQPCR. Science of the Total Environment. 382:130-134. 2007.

Vesper SJ, McKinstry C, Haugland RA, Iossifova Y, LeMasters G, Levin L, Hershey GKK, Villareal M, Bernstein DI, Reponen T. Relative moldiness index as predictor of childhood respiratory illness. Journal of Exposure Science and Environmental Epidemiology. 17:88-94. 2007.

Vesper SJ, Rogers ME, Neely A., Haugland RA. Opportunistic Aspergillus pathogens measured in home and hospital tap water by quantitative PCR (QPCR). Journal of Water and Health 5:427-431. 2007.

Vesper SJ, McKinstry C, Yang C, Haugland RA, Kercsmar CM, Yike I, Schluchter MD, Kirchner HL, Sobolewski J, Allan TM, Dearborn DG. Specific molds associated with asthma. Journal Occupational and Environmental Medicine. 48:852-858. 2006

Kercsmar CM, Dearborn DG, Schluchter MD, Xue L, Kirchner HL, Sobolewski J, Greenberg SJ, Vesper SJ, Allan TM,. Reduction in asthma morbidity in children as a result of home remediation aimed at moisture sources. Environmental Health Perspectives. 114:1574-1580. 2006

Murr AH, Goldberg AN, Vesper SJ. Fungal speciation using quantitative polymerase chain reaction (QPCR) in patients with and without Chronic Rhinosinusitis. The Laryngoscope. 116:1342-1348 2006.

Donohue M, Wei W, Wu J, Zawia NH, Hud N, De Jesus V, Schmechel D, Hettick JM, Beezhold DH, Vesper SJ. Characterization of Nigerlysin, hemolysin produced by Aspergillus niger,and effecton mouse neuronal cells in vitro. Toxicology 219:150-155. 2006.

Vesper SJ, Wymer LJ, Meklin T, Varma M, Stott R, Richardson M, Haugland RA. Comparison of populations of mould species in homes in the UK and USA using Mold-Specific Quantitative PCR (MSQPCR). Letters in Applied Microbiology. 41:367-373. 2005.

Chung Y, Coates NH, Viana ME, Copeland L, Vesper SJ, Selgrade MJK, Ward MDW. Dose-dependent allergic responses to an extract of Penicillium chrysogenum in BALB/c mice. Toxicology. 209:77-89. 2005.

Donohue M, Chung Y, Magnuson ML, Ward M, Selgrade MJ, Vesper SJ. Hemolysin, Chrysolysin from Penicillium chrysogenum, promotes inflammatory response. International Journal of Hygiene and Environmental Health. 208:279-285. 2005

Haugland RA, Meklin T, Varma M, Wymer L, Dearborn D, Yike I, Vesper S. Method to classify environmental samples based on mold analysis by QPCR. In: Bioaerosols, Fungi, Bacteria, Mycotoxions and Human Health: Patho-physiology, Clinical Effects, Exposure Assessment, Prevention and Control in Indoor Environments and Work. (E. Johanning, ed). Fungal Research Group, Inc. Albany , NY. Pp. 327-334. 2005

Vesper SJ, Varma M, Wymer LJ, Dearborn DG, Sobolewski J, Haugland RA. Quantitative PCR analysis of fungi in dust from homes of infants who developed idiopathic pulmonary hemorrhaging. Journal of Occupational and Environmental Medicine.46:596-601. 2004

Neely AN, Gallardo V, Barth E, Haugland RA, Warden G, Vesper SJ. Rapid monitoring by QPCR for pathogenic Aspergillus during carpet removal from a hospital. Infection Control and Hospital Epidemiology. 25:350-352. 2004.

Meklin T, Haugland RA, Reponen T, Varma M, Lummus Z, Bernstein D, Wymer LJ, Vesper SJ. Quantititive PCR analysis of house dust can reveal abnormal mold conditions. Journal of Environmental Monitoring. 6:615-620. 2004.

Morrison J, Yang C, Lin K.-T, Haugland RA, Neely AN, Vesper SJ. Monitoring Aspergillus species by quantitative PCR during construction of a multi-story hospital building. Journal of Hospital Infection. 57:85-87. 2004.

Haugland RA, Varma M, Wymer LJ, Vesper SJ. Quantitative PCR of Selected Aspergillus, Penicillium and Paecilomyces Species. Systematic and Applied Microbiology. 27:198-210. 2004

Van Emon JM, Reed AW, Yike I, Vesper SJ. ELISA Measurement of Stachylysin™ in serum to quantify human exposures to the indoor mold Stachybotrys chartarum. Journal of Occupational and Environmental Medicine. 45:582-591. 2003

Li D-W, Yang CS, Haugland RA, Vesper SJ. A new species of Memnoniella. Mycotaxon 85:253-257. 2003

Brinkman NE, Haugland RA, Wymer LJ, Byappanahalli M, Whitman RL, Vesper SJ. Evaluation of a rapid, quantitative real-time PCR method for cellular enumeration of pathogenic Candida species in water. Applied and Environmental Microbiology. 69:1775-1782. 2003

Gregory L, Rand TG, Dearborn DG, Yike I, Vesper SJ. Immunocytochemical localization of stachylysin in Stachybotrys chartarum spores and spore-impacted mouse and rat lung tissues. Mycopathologia 156:76-85.  2003

Yike I., Vesper SJ, Tomashefsky JF, Dearborn DG. Germination, viability and clearance of Stachybotrys chartarum in the lungs of infant rats. Mycopathologia. 156:67-75. 2003

Viana ME, Coates NH, Gavett SH, Selgrade MJK, Vesper SJ, Ward MDW. An extract of Stachybotrys chartarum causes allergic asthma-like response in a BALB/c mouse model. Toxicological Sciences. 70:98-109. 2002

Haugland RA, Brinkman N, Vesper SJ. Evaluation of rapid DNA extraction methods for the quantitative detection of fungal cells using real time PCR analysis. Journal of Microbiological Methods. 50:319-323. 2002

Vesper SJ, Vesper MJ. Stachylysin may be a cause of hemorrhaging in humans exposed to Stachybotrys chartarum. Infection and Immunity.70:2065-2070. 2002

Roe JD, Haugland RA, Vesper SJ, Wymer LJ. Quantification of Stachybotrys chartarum conidia in indoor dust using real-time, fluorescent probe-based detection of PCR products. Journal of Exposure Analysis and Environmental Epidemiology. 11:1-9. 2001

Haugland RA, Vesper SJ, Harmon SM. Phylogenetic Relationships of Memnoniella and Stachybotrys species inferred from ribosomal DNA sequences and evaluation of morphological features for Memnoniella species identification. Mycologia. 93:54-65. 2001

Vesper SJ, Magnuson ML, Dearborn DG, Yike I, Haugland RA. Initial characterization of the hemolysin Stachylysin from Stachybotrys chartarum. Infection and Immunity. 69:912-916. 2001

Vesper SJ, Dearborn DG, Elidemir O, Haugland RA. Quantification of siderophore and hemolysin from Stachybotrys chartarum strains, including a strain isolated from the lung of a child with pulmonary hemorrhage and hemosiderosis. Applied Environmental Microbiology. 66:2678-2681. 2000

Vesper SJ, Dearborn DG, Yike I, Allan T, Sobolewski J, Hinkley SF, Jarvis BB, Haugland RA. Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during and after remediation. Journal of Urban Health. 77:68-85. 2000

Haugland RA, Vesper SJ, Wymer LJ. Quantitative Measurement of Stachybotrys chartarum conidia using real-time detection of PCR products with the TaqMan™ fluorogenic probe system. Molecular and Cellular Probes. 13:329-340. 1999

Vesper SJ, Dearborn DG, Yike I, Sorenson WG, Haugland RA. Hemolysis, toxicity and RAPD analysis of Stachybotrys chartarum strains. Applied and Environmental Microbiology. 65:3175-3181. 1999

Jump to main content.