Jump to main content or area navigation.

Contact Us

Microbiological and Chemical Exposure Assessment

EPA Technology for Mold Identification and Enumeration

The presence of molds in homes, schools and business is of growing concern in the United States. To begin to understand the significance of exposure to these organisms, a standardized technology is needed for their identification and quantification. In May of 2002, the EPA was granted patent 6,387,652 which describes mold DNA sequences that makes their identification and quantification possible. This relatively inexpensive technology has been licensed by firms in the U.S., Germany and the United Kingdom (below).

The patented technology teaches the best available DNA sequences to use for over 130 of the major indoor air fungi. It is particularly useful, in that a a licensed company can employ a technician or robotic system to analyze samples and obtain highly reproducible results in only a few hours -- eliminating the need for plating and culturing or identifying and counting. Other analytical techniques may take days or week to complete. Most typical sampling systems can be adapted for use with this technology.

One of the problems with mold exposure estimates has been the lack of a standardized method for describing the mold burden in a home (Vesper 2010 , in press). United States Environmental Protection Agency (US EPA) and Department of Housing and Urban Development (HUD) researchers have developed a metric called the Environmental Relative Moldiness Index (ERMI) to objectively describe the home mold burden (Vesper et al. 2007). A DNA-based analysis called Mold Specific Quantitive PCR (MSQPCR) of 36 molds including, the 26 Group 1 species associated with homes with water damage and the 10 Group 2 species which are found in homes independent of water damage, forms the basis of the ERMI. (Figure 1, click once for values, click 2-5 times for quartiles) If the Sum of the Logs of the Group 2 (SLG2) molds is subtracted from the Sum of the Logs of the Group1 (SLG1) molds, a unit-less Environmental Relative Moldiness Index (ERMI) value is calculated which describes the mold burden in a home with a single numeric value relative to the National ERMI scale. The ERMI scale ranges from about -10 to 20 or even higher and is divided into quartiles. The homes in the lowest quartile have the lowest mold burden. Each higher quartile indicates more mold present in the home. The fourth quartile indicates homes with the highest mold burden (Vesper et al. 2007)

Literature references pertinent to this technology can be found at the end of this page.

Primers and Probes for Target Species

Absidia | Acremonium | Alternaria | Aspergillus | Aureobasidium | Candida | Chaetomium | Cladosporium | Emericella | Eurotium | Epicoccum | Fusarium | Geotrichum | Memnoniella | Mucor | Myrothecium | Paecilomyces | Penicillium | Rhizomucor | Rhizopus | Scopulariopsis | Stachybotrys | Trichoderma | Ulocladium | Wallemia | Universial Penicillium, Aspergillus, Paecilomyces |

Absidia corymbifera (assay name: Acory)

Acremonium strictum (assay name: Astrc)

Alternaria alternata (assay name: Aaltr)
Forward Primer AaltrF1: 5'-GGCGGGCTGGAACCTC

Aspergillus auricomus (assay name: Aauri)
Reverse Primer AauriR1: 5'-GGCGGCCGCGTAAAC

Aspergillus caespitosus (assay name: Acaes)

Aspergillus candidus (assay name: Acand3)
Reverse Primer AcandR2: 5'-CCCGCCGAAGCAACAG

Aspergillus carbonarius (assay name: Acarb)
Forward Primer AcarbF1-1: 5'-CTTTGGGCCCAACCTCCtAC
Reverse Primer AcarbR1: 5'-CCCGAGGGGCAGAGATG

Aspergillus cervinus (assay name: Acerv)

Aspergillus clavatus/giganteus (assay name: Aclav)
Forward Primer AclavF1: 5'-CCCGCCGTCTTCGGA

Aspergillus flavus/oryzae (assay name: Aflav)
Reverse Primer AflavR1: 5'-CCGGCGGCCATGAAT

Aspergillus fumigatus, Neosartorya fischeri (assay name: Afumi)
Forward Primer AfumiF1: 5'-GCCCGCCGTTTCGAC

Aspergillus flavipes (assay name: Aflvp2)

Aspergillus niger/awamori/foetidus/phoenicis (assay name: Anigr)
Forward Primer AnigrF1: 5'-GCCGGAGACCCCAACAC-3'

Aspergillus niveus (assay name: Anive)

Aspergillus ochraceus/ostianus (assay name: Aochr1)
Forward Primer AochrF1: 5'-AACCTCCCACCCGTGTATACC-3'
Reverse Primer AochrR1: 5'-CCGGCGAGCGCTGTG-3'

Aspergillus paradoxus (assay name: Apard)
Forward Primer ApardF1: 5'-CGGGGGGCTTACGCT

Aspergillus parasiticus/sojae (assay name: Apara)
Forward Primer AflavF1: 5'-CGAGTGTAGGGTTCCTAGCGA-3'
Reverse Primer AparaR3: 5'-GCCCGGGGCTGACG

Aspergillus penicillioides (assay name: Apeni2)
Forward Primer ApeniF2: 5'-CGCCGGAGACCTCAACC

Aspergillus puniceus (assay name: Apuni)
Reverse Primer AustsR1: 5'-GCCGAAGCAACGTTGGTC

Aspergillus restrictus/caesillus/conicus (assay name: Arest)
Forward Primer ArestF1: 5'-GGGCCCGCCTTCAT-3'

Aspergillus sclerotiorum (assay name: Asclr)
Reverse Primer AsclrR1: 5'-CCTAGGGAGGGGGGTTTGA

Aspergillus sydowii (assay name: Asydo3)
Forward Primer AsydoF1-1: 5'-CAACCTCCCACCCGAGAA

Aspergillus tamarii (assay name: Atama2)
Reverse Primer AtamaR2: 5'-CCCGGCGGCCTTAAAG

Aspergillus terreus (assay name: Aterr2)
Reverse Primer AterrR2: 5'-CCCGCCGAAGCAACAAG

Aspergillus unguis (assay name: Aungu)

Aspergillus ustus (assay name: Austs2)
Forward Primer AustsF2-1: 5'-AAGGATCATTACCGAGTGCAtGT
Reverse Primer AustsR1: 5'-GCCGAAGCAACGTTGGTC

Aspergillus versicolor (assay name: Avers2-2)
Forward Primer AversF2 (5x): 5'-CGGCGGGGAGCCCT

Aspergillus wentii (assay name: Awent)
Reverse Primer AwentR1: 5'-CGGCGGCCACGAAT

Aureobasidium pullulans (assay name: Apull)
Reverse Primer ApullR1: 5'-GCTCGCCTGGGACGAATC

Candida albicans (assay name: Calbi)

Candida dubliniensis (assay name: Cdubl)

Candida glabrata (assay name: Cglab)
Forward Primer Cglab F1: 5'-GCGCCCCTTGCCTCTC

Candida (assay name: Pichia) guilliermondii (assay name: Cguil)
Forward Primer CguiF1: 5'-CCTTCGTGGCGGGGTG
Reverse Primer CguiR1: 5'-GCAGGCAGCATCAACGC

Candida haemulonii, svar. 1 (assay name: Chaem1)

Candida haemulonii, svar. 2 (assay name: Chaem2)
Forward Primer Cha2F1: 5'-ATCGGGTGGAGCGGAACT

Candida krusei (assay name: Ckrus)
Reverse Primer CkruR1: 5'-GGGGCTCTCACCCTCCTG

Candida lipolytica (assay name: Clipo)
Reverse Primer ClipR1: 5'-CGTCGGTGGCAGTGTGGA

Candida lusitaniae (assay name: Clusi)
Reverse Primer Clus R2: 5'-GTCGGCGTGCGCCATA-3'

Candida maltosa (assay name: Cmalt)

Candida parapsilosis (assay name: Cpara)

Candida sojae (assay name: Csoja)

Candida tropicalis (assay name: Ctrop)
Forward Primer CtropF1: 5'-GCGGTAGGAGAATTGCGTT

Candida viswanathii (assay name: Cvisw)
Forward Primer CvisF1: 5'-CGGCAGGACAATCGCGT

Candida zeylanoides (assay name: Czeyl)

Chaetomium globosum (assay name: Cglob)
Forward Primer CglobF1: 5'-CCGCAGGCCCTGAAAAG
Reverse Primer CglobR1: 5'-CGCGGCGCGACCA

Cladosporium cladosporioides, svar. 1 (assay name: Cclad1)
Reverse Primer CcladR1: 5'-CCCCGGAGGCAACAGAG

Cladosporium cladosporioides, svar. 2 (assay name: Cclad2)
Forward Primer Cclad2F1: 5'-TACAAGTGACCCCGGCTACG
Reverse Primer CcladR1: 5'-CCCCGGAGGCAACAGAG

Cladosporium herbarum (assay name: Cherb)
Forward Primer CherbF1: 5'-AAGAACGCCCGGGCTT

Cladosporium sphaerospermum (assay name: Cspha)
Forward Primer CsphaF1: 5'-ACCGGCTGGGTCTTTCG
Reverse Primer CsphaR1: 5'-GGGGTTGTTTTACGGCGTG

Emericella (Aspergillus) nidulans/rugulosa/quadrilineata (assay name: Anidu2)
Forward Primer AversF1: 5'-CAACCTCCCACCCGTGAC

Emericella (Aspergillus) variecolor (assay name: Avari)
Forward Primer AversF2: 5'-CGGCGGGGAGCCCT

Eurotium (Aspergillus) amstelodami/chevalieri/herbariorum/rubrum/repens (assay name: Eamst)
Forward Primer EamstF1: 5'-GTGGCGGCACCATGTCT

Epicoccum nigrum (assay name: Enigr)

Fusarium solani f.sp. batatas MP II (Fsola2)
Forward Primer FsolaF2: 5'-CGCCGCAGCTTCCAAT

Fusarium solani f.sp. cucurbitae MP I (Fsola1)
Forward Primer FsolaF1: 5'-CAGCCGCAGCTTCCAGT
Reverse Primer FsolaR1-1: 5'-CGTGGCCGAGCCtCTG

Fusarium solani f.sp. mori MP III, Fusarium solani f.sp. cucurbitae MP V, Fusarium solani f.sp. pisi MP VI, Fusarium solani f.sp. robiniae MP VII (Fsola3)
Forward Primer FsolaF3: 5'-CGCCGCAGCTTCCATC

Fusarium solani f.sp. xanthoxyli MP IV (Fsola4)
Forward Primer FsolaF4: 5'-CGCCGCAGCTTCCATT

Geotrichum candidum strain UAMH 7863 (assay name: Geo - reference strain only)

Geotrichum candidum (assay name: Gcand2)

Geotrichum klebahnii (assay name: Gkleb1)
Forward Primer GklebF1: 5'-GGGCGACTTTTCCGGC

Memnoniella echinata (assay name: Mem)

Mucor amphibiorum/circinelloides/hiemalis/indicus/mucedo/racemosus/ramosissimus
and Rhizopus azygosporus/homothalicus/microsporus/oligosporus/oryzae (assay name: Muc1)

Myrothecium verrucaria (assay name: Mverr)

Paecilomyces lilacinus (assay name: Plila)

Paecilomyces variotii (assay name: Pvari2)
Forward Primer PvariF2: 5'-CGAAGACCCCTGGAACG

Penicillium aethiopicum (assay name: Paeth)
Forward Primer PaethF1-1: 5'-CGGGGGGCTCtCGCT

Penicillium atramentosum (assay name: Patra)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PatraR1: 5'-CCCCGGCGGCCATA

Penicillium aurantiogriseum/freii/polonicum/tricolor/viridicatum (assay name: PenGrp1A)
Forward Primer PexpaF1-1: 5'-TTACCGAGTGAGGGCCgTT
Reverse Primer PauraR6: 5'-CCCGGCGGCCAGTA

Penicillium aurantiogriseum/freii/hirsutum/polonicum/tricolor/viridicatum/verrucosum, svar. 2 (assay name: PenGrp1)
Forward Primer PauraF1: 5'-CGGGCCCGCCTTTAC

Penicillium brevicompactum/stoloniferum (assay name: Pbrev)
Forward Primer PbrevF3: 5'-GGCGAGCCTGCCTTTTG

Penicillium canescens (assay name: Pcane2)
Reverse Primer PcaneR2-1: 5'-CCGCCGAAGCAACAAGtTAC

Penicillium chrysogenum, svar. 2 (assay name: Pchry)
Forward Primer PchryF4-1: 5'-GCCTGTCCGAGCGTCACTT
Reverse Primer PchryR8: 5'-CCCCCGGGATCGGAG

Penicillium chrysogenum/griseofulvum/glandicola/coprophilum/expansum
and Eupenicillium crustaceum/egyptiacum (assay name: PenGrp3)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC

Penicillium citreonigrum (Pcteo2)
Forward Primer PcteoF2-1: 5'-GGGGGCATCTGCtCTCTG

Penicillium citrinum/sartoryi/westlingi (Pcitr)
Forward Primer PcitrF1: 5'-CCGTGTTGCCCGAACCTA

Penicillium coprophilum (assay name: Pcopr)
Forward Primer PcoprF1-1: 5'-GGGTCCAACCTCCCACtCA

Penicillium corylophilum (assay name: Pcory)
Forward Primer PcoryF1: 5'-GTCCAACCTCCCACCCA

Penicillium crustosum/camembertii/commune/echinulatum/solitum (assay name: PenGrp2)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC

Penicillium decumbens (assay name: Pdecu3)
Forward Primer PdecuF3: 5'-GGCCTCCGTCCTCCTTTG
Reverse Primer PdecuR4-1: 5'- GACCTACAGAGCGGGTGATGA

Penicillium digitatum (assay name: Pdigi)
Forward Primer PaethF1-1: 5'-CGGGGGGCTCtCGCT

Penicillium expansum (assay name: Pexpa)
Forward Primer PexpaF1-1: 5'-TTACCGAGTGAGGGCCgTT
Reverse Primer PexpaR2-1: 5'-GCCCGCCGAAGCtACG

Penicillium fellutanum/charlesii (assay name: Pfell2)
Forward Primer PfellF2: 5'- CTGAGTGCGGGCCCTCT
Reverse Primer PfellR2: 5'- CGCCGAAGCAACACTGTAAG

Penicillium glandicola (assay name: Pglan)
Forward Primer PglanF1-1: 5'-CCGGGGGGCTTtCGT

Penicillium griseofulvum (assay name: Pgris)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PchryR6: 5'-CCCGGCGGCCAGTT

Penicillium implicatum (assay name: Pimpl)
Forward Primer PimplF1: 5'-GCCGAAGACCCCCCTGT

Penicillium islandicum (assay name: Pisla)
Forward Primer PislaF1: 5'-CGAGTGCGGGTTCGACA
Reverse Primer PislaR1: 5'-GGCAACGCGGTAACGGTAG

Penicillium italicum (assay name: Pital)
Forward Primer PitalF1-1: 5'-CTCCCACCCGTGTTTATTTAtCA

Penicillium melinii (assay name: Pmeli)
Forward Primer PmeliF1-1: 5'-CACGGCTTGTGTGTTGGtCT
Reverse Primer PmeliR1: 5'-GGGCCTACAAGAGCGGAA

Penicillium miczynskii (assay name: Pmicz)

Penicillium olsonii (assay name: Polsn)
Forward Primer PolsnF1: 5'-GGCGAGCCTGCCTTCG

Penicillium oxalicum (assay name: Poxal)
Forward Primer PoxalF1: 5'-GGGCCCGCCTCACG

Penicillium purpurogenum (assay name: Ppurp)

Penicillium raistrickii (assay name: Prais3)
Forward Primer PgrisF1-1: 5'-ACCTGCGGAAGGATCATTtCT
Reverse Primer PraisR2: 5'-CCGGCGGCCTGACG

Penicillium restrictum (assay name: Prest2)
Forward Primer PrestF2-1: 5'-CACGGCTTGTGTGTTGGtCCT
Reverse Primer PrestR1-1: 5'-CGGCCGGGCCTaCAA

Penicillium roquefortii (assay name: Proqu)
Forward Primer PchryF1: 5'-CGGGCCCGCCTTAAC

Penicillium sclerotiorum (assay name: Psclr)
Forward Primer PsclrF1: 5'-TTCCCCCGGGAACAGG
Reverse Primer PsclrR1: 5'-GCCCCATACGCTCGAGGAT

Penicillium simplicissimum/ochrochloron (assay name: Psimp2)
Forward Primer PsimpF2-1: 5'-CGCCGAAGACACCATTGAtCT

Penicillium glabrum/lividum/pupurescens/spinulosum/thomii (assay name: Pspin2)
Reverse Primer PspinR2-1: 5'-CGTGAGGCGGGaGCA

Penicillium variabile (assay name: Pvarb2)
Forward Primer PvarbF2-1: 5'-TTACCGAGTGCGGGTTCtAA
Reverse Primer PvarbR2: 5'-CGAGGCAACGCGGTAAC

Penicillium verrucosum, svar. 1 (assay name: Pverr)
Forward Primer PverrF2: 5'-CGGGCCCGCCTTTG

Rhizomucor meihei/pusillus/variabilis (assay name: Rmuc)

Rhizopus stolonifer (assay name: Rstol)

Scopulariopsis asperula (assay name: SCaspr)

Scopulariopsis brevicaulis/fusca (assay name: SCbrv)

Scopulariopsis brumptii (assay name: SCbrm)

Scopulariopsis chartarum (assay name: SCchr)

Scopulariopsis sphaerospora (assay name: SCsph)

Stachybotrys chartarum (assay name: Stac)

Trichoderma asperellum/hamatum (assay name: Taspr1)

Trichoderma harzianum (assay name: Tharz)
Forward Primer TharzF1: 5'-TTGCCTCGGCGGGAT

Trichoderma longibrachiatum/citrinoviride (assay name: Tlong)
Forward Primer TlongF1: 5'-TGCCTCGGCGGGATTC

Trichoderma viride/atroviride/koningii (assay name: Tviri)
Reverse Primer TviriR1: 5'-TCCGCGAGGGGACTACAG

Ulocladium atrum (assay name: Uatrm)
Forward Primer UatrmF2: 5'-CGGGCTGGCATCCTTC

Ulocladium botrytis (assay name: Ubotr)
Forward Primer UbotrF1: 5'-CCCCCAGCAGTGCGTT

Ulocladium chartarum (assay name: Uchar)
Forward Primer UcharF1-1: 5'-AGCGGGCTGGAATCCaTT

Wallemia sebi (assay name: Wsebi)

Universal Penicillium, Aspergillus and Paecilomyces varioti (assay name: PenAsp1mgb)
Reverse Primer PenAspR1: 5'-GCCCGCCGAAGCAAC

* Applied Biosystems MGB probe, labeled with 6FAM reporter and black hole quencher. Suggest labeling of all other probes with 6FAM reporter and TAMRA or black hole quencher.

Suggested probe and primer concentrations for all assays is 80 nM probe, 1000 nM primers. Primers with (5x) designations indicate suggested use of 5x higher concentration.

Lower case letters in primer sequences denote deliberate mismatches with target sequences.

Environmental Relative Moldiness Index (ERMI) Research Tool (Fact Sheet)



Bolanos-Rosero B., Betancourt D., Dean T. and Vesper S. Pilot study of mold populations inside and outside of Puerto Rican residences. Aerobiologia 29(4):537-543. 2013.

Reponen T., Levin L., Zheng S. Vesper S., Ryan P., Grinspun S.A. and LeMasters G. Family and home characteristics correlate with mold in homes. Environmental Research 124:67-70. 2013.

Johansson E., Reponen T., Vesper S., Levin L., Lockey J., Ryan P., Bernstein D.I., Villareal M., Hershey G.K.K., Schaffer C. and LeMasters G. Microbial content of household dust associated with exhaled NO in asthmatic children. Environment International 59:141-147. 2013.

Kettleson E., Kumar S., Reponen T., Vesper S., Meheust D., Grinspun S. and Adhikari A. Stenotrophomonas, Mycobacterium and Streptomyces in home dust and air: associations with moldiness and other home/family characteristics. Indoor Air 23(5):387-396. 2013.

Meheust D., Le Cann P., Reponen P., Wakefield J., Vesper S. and Gangneux J-P. Possible application of the Environmental Relative Moldiness Index in France: a pilot study in Brittany. International Journal of Hygiene and Environmental Health 216:333-340. 2013.

Vesper S., Barnes C., Ciaccio C.E., Cox D., Dewalt G., Jacobs D.E., Johanns A., Kennedy K.,Nunez-Alvarez A., Sandel M.T. and Ashley P. Higher Environmental Relative Moldiness Index (ERMI) values measured in homes of asthmatic children in Boston, Kansas City and San Diego. Journal of Asthma 50:155-161. 2013.

Blanc P.B., Quinlan P.J., Katz P.P., Balmes J.R., Trupin L., Cisternas M., Wymer J. and Vesper S.J. Higher EnvironmentalEnvironmental Relative Moldiness Index values measured in homes of adult asthmatics. Environmenal Research 122:98-101. 2013.

Nonnenmann M., Coronado G., Thompson B., Griffith W., Vesper S. and Faustman E. Utilizing pyrosequencing and quantitative PCR to characterize fungal populations in house dust samples. Journal of Environmental Monitoring 14:2038-2043. 2012.

Meheust D., Gangneux J-P, Reponen T., Wymer L., Vesper S., and LeCann P. Correlation between Environmental Relative Moldiness Index (ERMI) values in French dwellings and other measures of fungal contamination. Science of the Total Environment 438:319-324. 2012.

Thomas T.G., Burton N., Mueller N.C., Page E. and Vesper S. Comparison of work-related symtoms and visual contrast sensitivity between employees at a severely water-damaged school and a school without significant water damage. American Journal of Industrial Medicine 55:844-854. 2012.

Reponen T., Lockey J., Berstein D.I., Vesper S.J., Levin L., Zheng S., Ryan P., Grinspun S.A., Villareal M., Hershey G.K.K. and LeMasters G. Infant origins of childhood asthma associated with specific molds. Journal of Allergy and Clinical Immunology 130:639-644. 2012.

Murr A.H., Goldberg A.N., Pletcher S.D., Dillehay K., Wymer L.J. and Vesper S.J. Some CRS patients have elevated populations of fungi in their sinuses. The Laryngoscope 122:1438-1445. 2012.

Nayak A.P., Green B.J., Schmechel D., Janotka E., Vesper S.J. and Beezhold D.H. Monoclonal antibodies to hyphal exoantigens derived from the opportunistic pathogen, Aspergillus terreus. Journal of Clinical and Vaccine Immunology 18:1568-1576. 2011.

Reponen T., Vesper S., Levin L., Johansson E., Ryan P., Burkle J., Grinspun S.A., Zheng S., Berstein D.I., Lockey J., Villareal M., Hershey G.K.K. and LeMasters G. High Environmental Relative Moldiness Index during infancy as a predictor of age seven asthma. Annals of Allergy, Asthma and Immunology 107:120-126. 2011.

Johansson E., Reponen T., Vesper S., Levin L., Burkle J., Ryan P., Grinspun G.A., Zheng S., Hershey G.K.K., Bernstein D.I., Lockey J. and LeMasters G. Streptomycetes in house dust: associations with housing characteristics and endotoxin. Indoor Air 21:300-310. 2011.

Lin K-T., Schrantz M., Sandagdorj O., Keng Y-F., Boothe G. and Vesper S. Comparison of mold concentrations quantified by MSQPCR in air and dust samples versus spore trap analysis. Frontiers in BioScience 3:108-114. 2011.

Vesper S., Wakefield J., Ashley P., Cox D., Dewalt G., Friedman W. Geographic Distribution of Environmental Relative Moldiness Index (ERMI) molds in U.S. Homes. Journal of Environmnetal and Public Health. 2011. doi:10.1155/2011/242457.

Vesper S. Traditional mould analysis compared to a DNA-based method of mould analysis. Critical Reviews in Microbiology 37:15-24. 2011.

Nayak A.P., Green B.J., Janotka E., Blachere F.M., Vesper S.J., Beezhold D.H. and Schmechel D. Production and Characterization of IgM monoclinical antibodies against hyphal antigens of Stachybotrys species. Hybridoma 30:29-36. 2011.

Reponen T., Singh U., Schaffer C., Vesper S., Johansson E., Adhikari A., Grinspun S.A., Indugula R., Ryan P., Levin L. and Lemasters G. Visually observed mold and moldy odor versus quantitatively measured microbial exposure in homes. Science of Total Environment 408:5565-5574. 2010.

Ward, M.D., Donohue, M.J., Chung, Y.J., Coeland, L., Shoemaker, J.A., Vesper S.J., Selgrade, M.K. Human serum IgE reacts with a Metarhizium anisopliae fungal catalase. International Archives of Allergy and Immunology. 150:343-351. 2009.

Vesper, S., McKinstry, C., Cox, D., Dewalt, G. Correlaton between ERMI values and other moisture and mold assessments of homes in the American Healthy Homes Survey. Journal of Urban Health 86:850-860. 2009.

Yap, J., Toh, Z.A., Goh, V., Ng, L.C., Vesper, S. Assessment of mould concentrations in Singapore shopping centers using Mould Specific Quantitative PCR (MSQPCR) analysis. Indian Journal of Microbiology 49:290-293. 2009.

Vesper, S.J., McKinstry, C., Bradham, K.D., Ashley,P., Cox, D., Dewalt, G., Lin, K-T. Screening tools to estimate mold burdens in homes. Journal of Occupational and Environmental Medicine 51:80-86. 2009.

Vesper SJ, Wong W, Kuo M, Pierson DL. Mold species in dust from the International Space Station identified and quantified by mold specific quantitative PCR. Research in Microbiology. 159:432-435. 2008.

Iossifova Y, Reponen T, Sucharew H, Succop P, Vesper S. Use of (1-3)-ß-D-glucan concentrations in dust as a surrogate method for estimating specific mold exposures. Journal of Environmental Monitoring. 18:225-232. 2008.

Vesper S, McKinstry C, Haugland R, Neas L, Hudgens E, Heidenfelder B, Gallagher J. Higher Environmental Relative Moldiness Index (ERMIsm) values measured in Detroit homes of severely asthmatic children.. Science of the Total Environment. 394:192-196. 2008.

Vesper S, McKinstry C, Hartmann C, Neace M, Yoder S, Vesper A. Quantifying Fungal Viability in Air and Water Samples using Quantitative PCR after Treatment with Propidium Monoazide (PMA). Journal of Microbiological Methods. 72:180-184. 2008.

Vesper SJ, McKinstry C, Ashley P, Haugland RA, Yeatts K, Bradham K, Svendsen E. Quantitative PCR Analysis of molds in the dust from homes of asthmatic children in North Carolina. Journal of Environmental Monitoring. 9:826-830. 2007.

Vesper SJ, McKinstry C, Haugland RA, Wymer L, Ashley P, Cox D, DeWalt G, Friedman W. Development of an environmental relative moldiness index for homes in the U.S. Journal of Occupational and Environmental Medicine. 49:829-833. 2007

Meklin T, Reponen T, McKinstry C, Cho S-H, Grinshpun SA, Nevalainen A, Vepsäläinen A, Haugland RA, LeMasters G, Vesper SJ. Comparison of mold concentrations in indoor and outdoor air sampled simultaneously and quantified by MSQPCR. Science of the Total Environment. 382:130-134. 2007.

Vesper SJ, McKinstry C, Haugland RA, Iossifova Y, LeMasters G, Levin L, Hershey GKK, Villareal M, Bernstein DI, Reponen T. Relative moldiness index as predictor of childhood respiratory illness. Journal of Exposure Science and Environmental Epidemiology. 17:88-94. 2007.

Vesper SJ, Rogers ME, Neely A., Haugland RA. Opportunistic Aspergillus pathogens measured in home and hospital tap water by quantitative PCR (QPCR). Journal of Water and Health 5:427-431. 2007.

Vesper SJ, McKinstry C, Yang C, Haugland RA, Kercsmar CM, Yike I, Schluchter MD, Kirchner HL, Sobolewski J, Allan TM, Dearborn DG. Specific molds associated with asthma. Journal Occupational and Environmental Medicine. 48:852-858. 2006

Kercsmar CM, Dearborn DG, Schluchter MD, Xue L, Kirchner HL, Sobolewski J, Greenberg SJ, Vesper SJ, Allan TM,. Reduction in asthma morbidity in children as a result of home remediation aimed at moisture sources. Environmental Health Perspectives. 114:1574-1580. 2006

Murr AH, Goldberg AN, Vesper SJ. Fungal speciation using quantitative polymerase chain reaction (QPCR) in patients with and without Chronic Rhinosinusitis. The Laryngoscope. 116:1342-1348 2006.

Donohue M, Wei W, Wu J, Zawia NH, Hud N, De Jesus V, Schmechel D, Hettick JM, Beezhold DH, Vesper SJ. Characterization of Nigerlysin, hemolysin produced by Aspergillus niger,and effecton mouse neuronal cells in vitro. Toxicology 219:150-155. 2006.

Vesper SJ, Wymer LJ, Meklin T, Varma M, Stott R, Richardson M, Haugland RA. Comparison of populations of mould species in homes in the UK and USA using Mold-Specific Quantitative PCR (MSQPCR). Letters in Applied Microbiology. 41:367-373. 2005.

Chung Y, Coates NH, Viana ME, Copeland L, Vesper SJ, Selgrade MJK, Ward MDW. Dose-dependent allergic responses to an extract of Penicillium chrysogenum in BALB/c mice. Toxicology. 209:77-89. 2005.

Donohue M, Chung Y, Magnuson ML, Ward M, Selgrade MJ, Vesper SJ. Hemolysin, Chrysolysin from Penicillium chrysogenum, promotes inflammatory response. International Journal of Hygiene and Environmental Health. 208:279-285. 2005

Haugland RA, Meklin T, Varma M, Wymer L, Dearborn D, Yike I, Vesper S. Method to classify environmental samples based on mold analysis by QPCR. In: Bioaerosols, Fungi, Bacteria, Mycotoxions and Human Health: Patho-physiology, Clinical Effects, Exposure Assessment, Prevention and Control in Indoor Environments and Work. (E. Johanning, ed). Fungal Research Group, Inc. Albany , NY. Pp. 327-334. 2005

Vesper SJ, Varma M, Wymer LJ, Dearborn DG, Sobolewski J, Haugland RA. Quantitative PCR analysis of fungi in dust from homes of infants who developed idiopathic pulmonary hemorrhaging. Journal of Occupational and Environmental Medicine.46:596-601. 2004

Neely AN, Gallardo V, Barth E, Haugland RA, Warden G, Vesper SJ. Rapid monitoring by QPCR for pathogenic Aspergillus during carpet removal from a hospital. Infection Control and Hospital Epidemiology. 25:350-352. 2004.

Meklin T, Haugland RA, Reponen T, Varma M, Lummus Z, Bernstein D, Wymer LJ, Vesper SJ. Quantititive PCR analysis of house dust can reveal abnormal mold conditions. Journal of Environmental Monitoring. 6:615-620. 2004.

Morrison J, Yang C, Lin K.-T, Haugland RA, Neely AN, Vesper SJ. Monitoring Aspergillus species by quantitative PCR during construction of a multi-story hospital building. Journal of Hospital Infection. 57:85-87. 2004.

Haugland RA, Varma M, Wymer LJ, Vesper SJ. Quantitative PCR of Selected Aspergillus, Penicillium and Paecilomyces Species. Systematic and Applied Microbiology. 27:198-210. 2004

Van Emon JM, Reed AW, Yike I, Vesper SJ. ELISA Measurement of Stachylysin™ in serum to quantify human exposures to the indoor mold Stachybotrys chartarum. Journal of Occupational and Environmental Medicine. 45:582-591. 2003

Li D-W, Yang CS, Haugland RA, Vesper SJ. A new species of Memnoniella. Mycotaxon 85:253-257. 2003

Brinkman NE, Haugland RA, Wymer LJ, Byappanahalli M, Whitman RL, Vesper SJ. Evaluation of a rapid, quantitative real-time PCR method for cellular enumeration of pathogenic Candida species in water. Applied and Environmental Microbiology. 69:1775-1782. 2003

Gregory L, Rand TG, Dearborn DG, Yike I, Vesper SJ. Immunocytochemical localization of stachylysin in Stachybotrys chartarum spores and spore-impacted mouse and rat lung tissues. Mycopathologia 156:76-85.  2003

Yike I., Vesper SJ, Tomashefsky JF, Dearborn DG. Germination, viability and clearance of Stachybotrys chartarum in the lungs of infant rats. Mycopathologia. 156:67-75. 2003

Viana ME, Coates NH, Gavett SH, Selgrade MJK, Vesper SJ, Ward MDW. An extract of Stachybotrys chartarum causes allergic asthma-like response in a BALB/c mouse model. Toxicological Sciences. 70:98-109. 2002

Haugland RA, Brinkman N, Vesper SJ. Evaluation of rapid DNA extraction methods for the quantitative detection of fungal cells using real time PCR analysis. Journal of Microbiological Methods. 50:319-323. 2002

Vesper SJ, Vesper MJ. Stachylysin may be a cause of hemorrhaging in humans exposed to Stachybotrys chartarum. Infection and Immunity.70:2065-2070. 2002

Roe JD, Haugland RA, Vesper SJ, Wymer LJ. Quantification of Stachybotrys chartarum conidia in indoor dust using real-time, fluorescent probe-based detection of PCR products. Journal of Exposure Analysis and Environmental Epidemiology. 11:1-9. 2001

Haugland RA, Vesper SJ, Harmon SM. Phylogenetic Relationships of Memnoniella and Stachybotrys species inferred from ribosomal DNA sequences and evaluation of morphological features for Memnoniella species identification. Mycologia. 93:54-65. 2001

Vesper SJ, Magnuson ML, Dearborn DG, Yike I, Haugland RA. Initial characterization of the hemolysin Stachylysin from Stachybotrys chartarum. Infection and Immunity. 69:912-916. 2001

Vesper SJ, Dearborn DG, Elidemir O, Haugland RA. Quantification of siderophore and hemolysin from Stachybotrys chartarum strains, including a strain isolated from the lung of a child with pulmonary hemorrhage and hemosiderosis. Applied Environmental Microbiology. 66:2678-2681. 2000

Vesper SJ, Dearborn DG, Yike I, Allan T, Sobolewski J, Hinkley SF, Jarvis BB, Haugland RA. Evaluation of Stachybotrys chartarum in the house of an infant with pulmonary hemorrhage: Quantitative assessment before, during and after remediation. Journal of Urban Health. 77:68-85. 2000

Haugland RA, Vesper SJ, Wymer LJ. Quantitative Measurement of Stachybotrys chartarum conidia using real-time detection of PCR products with the TaqMan™ fluorogenic probe system. Molecular and Cellular Probes. 13:329-340. 1999

Vesper SJ, Dearborn DG, Yike I, Sorenson WG, Haugland RA. Hemolysis, toxicity and RAPD analysis of Stachybotrys chartarum strains. Applied and Environmental Microbiology. 65:3175-3181. 1999

Jump to main content.